mebasinger2002 mebasinger2002
  • 03-04-2018
  • Biology
contestada

Explain why Zygote is important to sexual reproduction

Respuesta :

breflowers71 breflowers71
  • 03-04-2018
A zygote is important to sexual reproduction because it involves joining together haploid gamete cells from each parent with half the normal number of chromosomes to make a new cell containing both parents' genetic material.
Answer Link

Otras preguntas

define the following text structures: claim/evidence compare/contrast cause and effect summary
Please help me fast math
A box contains orange balls and green balls. The number of green balls is nine more than two times the number of orange balls. If there are 54 balls altogether,
which core business process outlines what needs to be done and who is going to do it?
If P dollars are invested today at an annual interest rater compounded once a year, then the value of the account A after 2 years is given by the formula A - P(
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
A group of LANs connected together forms a: A. POP B. WAN C. MAC D. IP
does anybody Have a brainly plus account that I can use plz it’s ok if you don' Wants to share​
Which is not an example of a compound? O3 H2O2 NCl3 KOH
be3bl08r.42.028 Quest Future interests in land O a. cannot be bought and sold. O b. must create a right to, not merely the possibility of, possession at some ti