nadiafloressss9416 nadiafloressss9416
  • 01-08-2017
  • Business
contestada

Salespeople bringing suggestions for a new fast food item to the headquarters of their food manufacturer is an example of ________

Respuesta :

andriansp andriansp
  • 07-08-2017
Salespeople bringing suggestions for a new fast food item to the headquarters of their food manufacturer is an example of: Idea Generation
idea generation refers to developing facts and data into an abstract concept that will lead to an idea. This is the step that salespeople need to solve before they can move to constructing that abstract concept into an executable idea.
Answer Link

Otras preguntas

What is the primary purpose of the Supremacy Clause?
How do I factor polynomials by grouping, step by step? 4x^2 - 19x+ 12
what is 15/24 in simplest form
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
The section of the small intestine between the duodenum and ilium?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Did feudalism create a stable form of government?
Which of the following was not an accomplishment of the emperor Trajanlegalized Christianity       built bridges, aqueducts and harbors       reduced taxes
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
A vehicle is only 15% efficient. What happened to the other 85%?