Seudónimo Seudónimo
  • 01-04-2015
  • Mathematics
contestada

How can you use a right angle to dicide how to name another angle?

Respuesta :

Makanzi
Makanzi Makanzi
  • 01-04-2015
If it is a square, subtract (90+ whatever the other angle is) from 360. If it is a triangle than add 90 plus whatever other number the other angle is then subtract it from 180. A triangle is 180 degrees, and a square is 360 degrees.
Answer Link

Otras preguntas

How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what rule does static electricity follow
What is the sum of 6/10 plus 7/12
how would u form a superlative for the adverb widely
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
How many times does four go into 153 ? What Is the remainder ?
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?