ch2fcj7dkn ch2fcj7dkn

03-06-2022
Mathematics

contestada

Which equation illustrates the matrix associative property of addition

Which equation illustrates the matrix associative property of addition class=

Respuesta :

MathHelperForLife MathHelperForLife

03-06-2022

Answer:

c

cuz it is

first of all 4,3 + 0,0 = 4,3

2,1+0,0 = 2,1

and which is the answer

Answer Link

Otras preguntas

If XY=18, YZ=14, and XZ=20, find the radius of each circle.

What name was given to the fight over slavery in the Kansas territory in the mid-1800’s?

Find the absolute maximum and minimum values of the function f(x, y) = x2 + xy + y2 on the disc x2 + y2 ≤ 1. (you do not have to use calculus.)

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Write about the formation of Himalayas

Joseph and cleoma, who made the first cajun recording, were husband and wife

With the two endpoints of a diamter how many right triangles can be formed

In a survey, a group of students were asked to name their favorite day of the week. There were 8 students who chose “other”. How many students participated? Sa

Jacqui has grades of 87 and 84. if she wants an average of 78 what does she have to score

Everfi the person who receives financial protection from a life insurance plan is called a: