asapjvzz5462 asapjvzz5462

02-11-2021
Medicine

contestada

What is gentamicin sulfate ophthalmic solution used for?

Respuesta :

lololori lololori

02-11-2021

Ophthalmic gentamicin is used to treat certain eye infections. Gentamicin is in a class of medications called antibiotics.

Answer Link

Otras preguntas

behaving in an acceptance manner within a workplace environment is refered to as a workplace etiquette. true or false

need help anybody know how to do this

Exercise has numerous health benefits. It conditions your heart and lungs and helps your body fight disease. Many people believe that exercise can help you look

Secured it means a lender gives you money in exchange for what?

During the song dynasty, the chinese economy expanded because question 19 options: new fishing methods created a surplus of food. song warriors destroyed the mo

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Renaissance painters in flanders as in italy tended to produce work that was

What is the value of x?

What central idea does wollstonecraft explicitly state in this passage? a lack of education will not make women care only about household issues. women are natu

Kalina is choosing a sandwich and a drink for lunch. She can choose between turkey, ham, and vegetarian sandwiches. She chooses her drink from a selection of wa