Officiallyjanya Officiallyjanya
  • 04-08-2021
  • Mathematics
contestada

How much of a circle does a 100-degree angle turn through?
A.1
B.100/180
C.50/360
D.100/360

Respuesta :

wegnerkolmp2741o
wegnerkolmp2741o wegnerkolmp2741o
  • 04-08-2021

Answer:

100/360

Step-by-step explanation:

A circle is 360 degrees

100/360

10/36

5/18

Answer Link

Otras preguntas

Homosociality reflects children's tendency to prefer social interactions with
A train leaves new york at 4:00 pm. a second train leaves the same city in the same direction at 6:00 pm. the second train travels 60mph faster than the first.
WILL MARK THE BRAINIEST!!!!! A biologist just found a new organism living in the deep ocean and is unsure whether or not to classify it as an animal. Describe t
need help anybody know how to do this
Which type of oscillation would most likely produce an electromagnetic wave?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Why do you think the Little Rock Nine deserve to be admired? Give two reasons for your opinion.
For which of the following materials is necessary to stop a beta particle? A. Three feet of concrete B. Three inches of lead C. Thin pieces of wood D. Single s
Renaissance painters in flanders as in italy tended to produce work that was
A guaranteed protection against vague laws is known as which of the following?