aespinal46
aespinal46 aespinal46
  • 04-08-2020
  • Biology
contestada

Please I need help with this

Please I need help with this class=

Respuesta :

haleywong haleywong
  • 04-08-2020
TAAGCCGATAAATGCTAACGGTA
Answer Link

Otras preguntas

PLSSSSSHELPMEWITHTHISONEQUESTIONPLEASE
Due to NAFTA, it is possible that a weak economy in the United States will have a(n) a0 effect on the economy in Mexico.\
Please help!!! What’s the height?
The ozone layer absorbs
Jonathon had 4 4/ 5  pounds of ground beef. He used some of the ground beef to make hamburgers. He had 1 1/ 5  pounds of ground beef left over. How much groun
A teacher has 27 students in her class .She asks the students to form as many groups as possible.How many students will not be in a group
Describe the base-pairing rules in any DNA molecule
in anton chekhov’s the proposal, lomov talks about how much land he owns instead of making romantic gestures while trying to propose to natalya. which idea infl
How can the market for a good or service influence business decisions?
When Gianna asks for 4 feet ribbon the clerk measures a 48- inch piece. How many inches long is a 9- foot piece of ribbon