autumhammett200 autumhammett200

03-04-2020
Mathematics

contestada

What is 240,000 divided by 1962.5 ?

Respuesta :

barbforlife barbforlife

03-04-2020

Answer:

122.293

Step-by-step explanation:

Answer Link

Otras preguntas

How to find the length of a triangle with only one side non right triangle?

On The Magic School Bus, you find yourself traveling from Earth to the Moon. It is approximately 240 million miles. Once there, you realize you must turn 90 deg

Helena has five different flowers. She plans to give one flower to each of her five teachers in any order. She gives the first flower to one of her teachers in

Boris has scored 80, 93, 63, 83, and 83 on his previous five tests. what score does he need on his next test so that his average (mean) is 79?

With this sole proprietorship, who pays the taxes?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Given that A=xy find the percentage increase in A when both X and Y increase by 10%

The_____ form acidic compounds with hydrogen.

Paul has grades of 86 and 85 on his first two tests. what must he score on his third test in order to have an average of at least 90

If you’re over 21 you could be arrested for a DUI if your PAC is at or over ? Thanks