cassidy100117 cassidy100117

01-02-2019
Mathematics

contestada

What is
the midpoint of NP IF N (1,9) and P (-5-1)

Respuesta :

meredith48034 meredith48034

01-02-2019

(-5+1)/2= -4/2= -2

(9+(-1))/2= 8/2= 4

Answer Link

Otras preguntas

explain how changing the point of view of a character to another would change the story for example, little red riding hood and the big bad wolf

Jackie baked 6 pizzas. Her sister took 1 and 1/4 of the pizza home. How much pizza is left?

domain 6range8,7,-5,6 is this a function or not

Highly confused on this problem

what's the difference between the structure of a nucleic acid and the structure of a protein?

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

Helpppp quickkkk WILL GIVE BRAINLY

In your opinion, would the United States have grown into a major world power if it had not been able to establish a national economy, free from barriers impose

the failure of sister chromatids to separate properly during cell division

slope and points y-12=4/9(x+7)